NEED A PERFECT PAPER? PLACE YOUR FIRST ORDER AND SAVE 15% USING COUPON:

Gene Annotation For the gene annotation assignment, you will be assigned unknown DNA sequence that you will have to identify and annotate by completing the

Gene Annotation For the gene annotation assignment, you will be assigned unknown DNA sequence that you will have to identify and annotate by completing the

Click here to Order a Custom answer to this Question from our writers. It’s fast and plagiarism-free.

Gene Annotation For the gene annotation assignment, you will be assigned unknown DNA sequence that you will have to identify and annotate by completing the following task.

Must include screenshots at each step

Identify the open reading frame (ORF). Must describe the frame strand, positive or negative, frame 1, 2 or 3, what it means,
List the top three hits providing statistics such as, e-value, identity score, length etc. use the top hit to describe how the query aligns with the subject including the definitions as necessary. Use screenshot to explain.
Coding Sequence (CDS) Coding regions. State the coordinates of the start and stop codon. Or state if the gene is protein coding or not
Genomic location: State the chromosome on which the gene is found and location
List of exons
What is the gene name, organism, and gene id encoded by this DNA sequence? You can use any of the genomic browsers already covered. Explain why you concluded the sequence belong to the gene you have named.

Do not cut and paste your database results to report your findings. Write two to three paragraphs reporting the information you have obtained about this gene. Imagine this is a report you will present to an employer or a group of researchers interested in this gene.

here is the sequence:

 

ATGGACGGCCCCGGGGCCAGCGCCGTGGTCGTGCGCGTCGGCATCCCGGACCTGCAGCAGACGAAGTGCC

TGCGCCTGGACCCGACCGCGCCCGTGTGGGCCGCCAAGCAGCGCGTGCTCTGCGCCCTCAACCACAGCCT

CCAGGACGCGCTCAACTATGGGCTTTTCCAGCCGCCCTCCCGGGGCCGCGCCGGCAAGTTCCTGGACGAG

GAGCGGCTCCTGCAGGACTACCCGCCTAATCTGGACACGCCCCTGCCCTACCTGGAGTTTCGATACAAGC

GGCGAGTTTATGCCCAGAACCTCATCGATGATAAGCAGTTTGCAAAGCTTCACACAAAGGCGAACCTGAA

GAAGTTCATGGACTATGTCCAGCTGCATAGCACAGACAAGGTGGCCCGCCTGCTGGACAAGGGGCTGGAC

CCCAACTTCCATGACCCTGACTCAGGAGAGTGCCCCCTGAGCCTTGCAGCCCAGCTGGACAATGCCACGG

ACCTGCTGAAGGTGCTGAAGAACGGCGGTGCCCACCTGGACTTTCGCACTCGTGATGGGCTCACTGCTGT

GCACTGTGCCACACGCCAGCGGAATGCAGCGGCATTGACGACCCTGCTGGACCTGGGGGCATCACCTGAC

TACAAGGACAGCCGCGGCTTGACACCCCTCTACCACAGCGCCCTGGGGGGTGGGGATGCCCTCTGCTGTG

AGCTGCTTCTCCACGACCATGCTCAGCTGGGGACCACCGACGAGAATGGCTGGCAGGAGATCCACCAGGC

CTGCCGCTTCGGGCACGTGCAGCACCTGGAGCACCTGCTCTTCTACGGGGCAGACATGGGGGCCCAGAAC

GCCTCAGGGAACACAGCCCTGCACATCTGTGCCCTCTACAACCAGGAGAGCTGTGCTCGTGTCCTGCTCT

TCCGTGGAGCCAACAGGGATGTGCGTAACTACAACAGCCAGACAGCCTTCCAGGTGGCCATCATCGCAGG

GAACTTTGAGCTTGCAGAGGTTATCAAGACCCACAAAGACTCGGATGTTGTACCATTCAGGGAAACTCCC

AGCTATGCGAAGCGGCGGCGACTGGCTGGCCCCAGTGGCTTGGCATCCCCTCGGCCTCTGCAGCGCTCAG

CCAGCGATATCAACCTGAAGGGGGAGGCGCAGCCGGCAGCTTCTCCTGGACCCTCGCTGAGAAGCCTCCC

CCACCAGCTGCTGCTCCAGCGGCTGCAGGAGGAGAAAGATCGTGACCGGGATGCCGACCAGGAGAGCAAC

ATCAGTGGCCCCTTAGTAGGCAGGGGCAGCCAGAGCAAGATCAGCCCGAGCGGGCCTGGCGGCCCTGGCC

CTGCGCCCGGCCCCGGCCCCGCGCCCCCCGCGCCCCCCGCGCCGCCGCCCCGGGGCCCGAAGCGGAAACT

TTACAGCGCAGTCCCCGGCCGCAAGTTCATCGCTGTGAAGGCGCACAGCCCGCAGGGCGAAGGCGAGATC

CCGCTGCACCGCGGAGAGGCCGTGAAGGTGCTCAGCATTGGGGAGGGCGGTTTCTGGGAGGGAACCGTGA

AAGGCCGCACGGGCTGGTTCCCGGCTGACTGCGTGGAGGAGGTGCAGATGAGGCAGCATGACACGAGGCC

TGAAACCCGTGAGGACCGGACAAAGCGGCTTTTTCGGCACTACACTGTGGGCTCCTACGACAGCCTCACC

TCACACAGCGATTATGTCATTGATGACAAAGTGGCCGTCCTGCAGAAACGGGACCACGAGGGCTTTGGTT

TTGTGCTCCGGGGAGCCAAAGCAGAGACCCCCATCGAGGAGTTCACGCCCACACCAGCCTTCCCAGCGCT

GCAGTATCTTGAGTCGGTGGACGTGGAGGGTGTGGCCTGGAAGGCCGGGCTTCGCACAGGAGACTTCCTC

ATTGAGGTGAATGGGGTGAACGTGGTGAAGGTTGGACACAAGCAGGTGGTAGCTCTGATCCGCCAGGGTG

GCAACCGCCTTGTCATGAAGGTTGTGTCTGTGACAAGAAAGCCGGAAGAGGATGGGGCTCGGCGCAGAGC

CCCACCGCCCCCCAAGAGGGCCCCCAGCACCACACTGACCCTGCGCTCCAAGTCCATGACAGCTGAGCTC

GAGGAACTTGCCTCCATTCGGAGAAGAAAAGGGGAGAAGCTGGACGAGATGCTGGCAGCCGCCACAGAGC

CGACGCTGAGGCCAGACATCGCAGACGCGGACTCCAGAGCCGCCACAGTCAAACAGCGGCCCACCAGTCG

GAGGATCACACCTGCTGAGATTAGTTCATTGTTTGAACGCCAGGGCCTCCCAGGCCCAGAGAAGCTGCCG

GGCTCCTTGCGGAAGGGGATTCCACGGACCAAATCTGTAGGGGAGGACGAGAAGCTGGCGTCCCTGCTGG

AAGGGCGCTTCCCGCGGAGCACGTCGATGCAAGACCCGGTGCTGCGCGAGAGTCGCGGCATCCCGCCCCC

GCCGCAGACCGCGCCGCCGCCCCCGCCCGCGCCCTACTACTTCGACTCGGGGCCGCCCCCGGCCTTCTCG

CCGCCGCCCCCGCCGGGCCGCGCCTACGACACGGTGCGCTCCAGCTTCAAGCCCGGCCTGGAGGCGCGCC

TGGGCGCGGGGGCTGCCGGCCTGTACGATCCCGGCGCGGCCCTCGGCCCGCTGCCCTACCCCGAGCGGCA

GAAGCGCGCGCGCTCCATGATCATCCTGCAGGACTCGGCGCCGGAGACGAGCGACGTCCCCCGGCCCCCG

CCCGCAGGCACCCCGCCCGAGCGCCCCAAGCGCCGGCCGCGGCCGCCCGGCCCCGACAGCCCCTATGCCA

ACCTGGGCGCCTTCAGCGCCAGCCTCTTCGCGCCGTCCAAGCCGCAGCGCCGCAAGAGCCCGCTGGTGAA

GCAGCTGCAGGTGGAGGATGCGCAGGAGCGCGCGGCCCTGGCCGTGGGCAGCCCCGGGCCCGGCGGCGGC

AGCTTCGCACGCGAGCCCTCCCCGACCCACCGTGGTCCCCGACCCGGCGGCCTCGACTACGGCGCGGGCG

ACGGCCCGGGGCTCGCGTTCGGCGGCCCGGGCCCGGCCAAGGACCGGCGGCTGGAGGAGCGGCGCCGCTC

CACTGTGTTCCTGTCCGTGGGCGCCATCGAGGGCAGCGCCCCCAGCGCGGACCTGCCATCCCTGCAGCCC

TCCCGCTCCATCGACGAGCGCCTCTTGGGCACCGGCCCCACCGCCGGCCGCGACTTGCTGCTGCCCTCCC

CGGTGTCTGCTCTGAAGCCATTGGTCAGCGGCCCGACCCTCGGGCCCTCAGGCTCCACCTTCATCCACCC

GCTCACCGGCAAACCCCTGGACCCCAGCTCACCCCTGGCCCTTGCCCTGGCTGCCCGAGAGCGGGCTCTG

GCCTCCCAGGCACCCTCCCGGTCCCCCACGCCCGTGCACAGCCCCGACGCCGACCGCCCTGGACCCCTGT

TTGTGGATGTGCAGGCCCGGGACCCAGAGCGAGGGTCCCTGGCGTCGCCAGCCTTCTCCCCGCGAAGCCC

GGCCTGGATTCCTGTGCCTGCTCGCAGGGAGGCAGAGAAGGCCCCCCGGGAGGAGCGGAAGTCACCTGAG

GACAAGAAGTCCATGATCCTCAGCGTTCTGGACACATCCCTGCAGCGGCCAGCCGGCCTCATCGTTGTGC

ATGCCACCAGCAACGGGCAGGAGCCCAGCAGGCTGGGGGCCGAAGAGGAGCGCCCGGGCACCCCGGAGTT

GGCCCCGGCCCCCATGCAGTCAGCGGCTGTGGCTGAGCCCCTGCCCAGCCCCCGGGCCCAGCCCCCTGGC

AGCACCCCGGCAGAACCTGGGCCAGGTCAGGGCAGCTCAGAGGAAGAGCCAGAGCTGGTGTTTGCTGTGA

ACCTACCACCCGCTCAGCTGTCGTCTAGCGATGAGGAGACCAGGGAGGAGCTGGCCCGGATTGGGCTGGT

GCCACCCCCAGAAGAGTTTGCCAACGGGGTCCTGCTGGCCACCCCACTCGCTGGCCCGGGCCCCTCGCCC

ACCACGGTGCCCAGCCCGGCCTCAGGGAAGCCCAGCAGTGAGCCACCCCCTGCCCCTGAGTCTGCAGCCG

ACTCCGGGGTGGAGGAGGCTGACACACGCAGCTCCAGCGACCCCCACCTGGAGACCACAAGCACCATCTC

CACGGTGTCCAGCATGTCCACCTTGAGCTCAGAGAGCGGGGAACTCACTGACACCCACACCTCCTTCGCT

GACGGACACACTTTTCTACTCGAGAAGCCACCAGTGCCTCCCAAGCCCAAGCTCAAGTCCCCGCTGGGGA

AGGGGCCGGTGACCTTCAGGGACCCGCTGCTGAAACAGTCCTCGGACAGCGAGCTTATGGCCCAGCAGCA

CCATGCCGCCTCTGCCGGGCTGGCCTCTGCCGCCGGGCCTGCCCGCCCTCGCTACCTCTTCCAGAGAAGG

TCCAAGCTATGGGGGGACCCCGTGGAGAGCCGGGGGCTCCCTGGGCCTGAAGACGACAAACCAACTGTGA

TCAGTGAACTCAGCTCCCGCCTGCAGCAGCTGAACAAAGACACGCGTTCCCTGGGGGAGGAACCAGTTGG

TGGCCTGGGCGGCCTGCTGGACCCTGTCAAGAAGTCGCCCATCGCAGCAGCTCGGCTCTTCAGCAGCCTC

GGTGAGCTGAGCTCCATTTCAGCGCAGCGCAGCCCCGGGGGCCCGGGCGGCGGGGCCTCCTACTCGGTGA

GGCCCAGCGGCCGCTACCCCGTGGCGCGACGCGCCCCGAGCCCTGTGAAGCCCGCGTCGCTGGAGCGGGT

GGAGGGGCTGGGGGCGGGCGCGGGGGGAGCAGGGCGGCCCTTCGGCCTCACGCCCCCCACCATCCTCAAG

TCGTCCAGCCTCTCCATCCCGCACGAGCCCAAGGAGGTGCGCTTCGTGGTGCGCAGCGTGAGCGCACGCA

GCCGCTCCCCCTCGCCATCGCCGCTGCCCTCGCCCGCGTCCGGCCCCGGCCCCGGCGCCCCCGGCCCGCG

CCGGCCCTTCCAGCAGAAGCCGCTGCAGCTCTGGAGCAAGTTCGACGTGGGCGACTGGCTGGAGAGCATC

CACCTGGGCGAGCACCGTGACCGCTTCGAGGACCATGAGATCGAAGGCGCGCACCTCCCCGCGCTCACCA

AGGACGACTTCGTGGAGCTGGGCGTCACGCGCGTGGGCCACCGCATGAACATCGAGCGCGCGCTCAGGCA

GCTGGACGGCAGCTGA

Place your order now for a similar assignment and have exceptional work written by one of our experts, guaranteeing you an A result.

Need an Essay Written?

This sample is available to anyone. If you want a unique paper order it from one of our professional writers.

Get help with your academic paper right away

Quality & Timely Delivery

Free Editing & Plagiarism Check

Security, Privacy & Confidentiality